Transcription pediatric meningioma patients who underwent surgery between

Transcription of all protein-coding genes is mediated by RNA polymerase II, which makes it obligatory for eukaryotic cell’s life. Any human disorder associated genomic mutations altering this enzyme have not been reported till recently, which authenticates its indispensable role in cell biology. Several examples of genomic aberrations in components of transcriptional regulation are reported in variety of tumors. These include histone H3.1/3.3 mutations in pediatric glioblastoma, DIPG/midline gliomas, mediator subunit mutations in uterine leiomyosarcoma, and specific transcription factors associated mutations in other tumor types.1,5
Therefore, in line with identification of histone H3 mutations, particularly in pediatric GBMs, we expected that POLR2A, which is also a transcriptional regulator, may show frequent mutation as compared to adult meningioma.
Tissue samples from 40 pediatric meningioma patients who underwent surgery between January-2002 to June-2015 and had adequate material in the paraffin blocks were retrieved from the Neuropathology laboratory. All cases were reviewed according to 2016 WHO-criteria by three neuropathologists. The study was approved by Institutional Ethics Committee for performing experiments on human patient samples and waived patient informed consent based on the retrospective study design. A detail of clinical, molecular pathology and follow-up data of these cases has been previously described.4 For DNA extraction, 10 sections of 5-µm from formalin-fixed paraffin-embedded tumor samples were deparaffinized with xylene, and RecoverAll nucleic acid extraction kit (Invitrogen, Carlsbad,CA) was then used for DNA extraction using manufacturer’s protocol. The Sanger method was applied for bidirectional sequencing of PCR products. POLR2A hotspot mutations Q403>K(p.Gln403Lys) and L438>H (p.Leu438_His439del) located in exon-7, reported in adult meningiomas was analyzed in 40 pediatric meningiomas. Oligonucleotides (sense 5?- CAAGGAGGAATTGAAGTTCTGA -3?, antisense 5?- CCTGCCCTATCTTGGAAAGC -3?; PCR product size: 298 bp) were synthesized using Primer3. Thermal conditions:10 min at 96°C followed by 45 s at 96°C, 45 s at 60°C and 90 s at 72°C for 42 cycles, final extension at 72°C for 10 min was used for PCR reaction. The Big Dye Terminator kit (Applied Biosystems, Foster City, CA, USA) was used for sequencing and the products were purified using NaOAc and EDTA. Samples were run on an ABI 3500xl capillary sequencer (Applied Biosystems) and sequences were assembled with SeqA6 software and analyzed.
Four of 40 patients had a diagnosis of neurofibromatosis type 2 (NF2). Multiple meningiomas were noted in three patients. According to histopathological criteria, Grade I meningiomas included transitional (45.5%), meningothelial (21.2%), psammomatous (18.2%) and fibroblastic (15.2%) variants. There were six high grade tumors in which Grade II meningiomas included atypical (83.3%), clear cell (16.7%) and one Grade III rhabdoid meningioma. Other clinical characteristics are detailed in table. Using the above-mentioned protocol, POLR2A gene sequencing was successfully performed in all 40 cases. Sequencing data analysis revealed wild-type POLR2A status of analyzed exon in all the cases and none were harboring deleterious mutation in any of the examined samples. One deletion/insertion variation found in position of previously described polymorphisms in dbSNPs: rs25603 (-/GCTCTGGGGT) of 10 bp in POLR2A intron-6, both in homozygous and heterozygous state was identified in 16/40 (40%) cases. This SNP has not showed any significant correlation with either tumor location, WHO grade or meningioma variants. Although, this polymorphic variation has not been reported in any other cancer and dbSNPs shows a MAF/MinorAlleleCount: C=0.00007/2. This observation indicates that further studies are required to confirm the impact of this sequence variant on the risk of meningioma in our population. Overall, present study did not identify the POLR2A hotspot mutation analyzed. Whereas these hotspot POLR2A mutations (Q403>K and L438>H) have been reported in 8% of the adult meningiomas and exclusively in grade I tumors.1 Clinically, POLR2A-mutant tumors have been reported to show distinct characteristics, including meningothelial histology and a tendency to originate from the tuberculum sellae.
The Pol II holoenzyme mediates multiple essential cellular processes, such that mutations affecting its subunits can potentially drive neoplasia through a range of biological mechanisms. The POLR2A mutant subgroup of meningiomas have been identified with a super-enhancer covering the WNT6 and WNT10A gene locus and it was found to be differentially activated relative to other groups.1 In contrary, a super-enhancer encompassing a meningeal identity gene ZIC1 and ZIC4 were found to be lost in POLR2A-mutant meningiomas. These findings highlighted POLR2A associated WNT and ZIC signaling in the growth and differentiation of meningeal progenitors.1 Therefore, it would be interesting to examine if the polymorphic SNP located at POLR2A intron-6 identified in this study lies in some enhancer and act as distal regulatory elements that may regulate gene transcription.
In conclusion, pediatric meningiomas seem to be genetically a very distinct entity from adult counterparts. A high throughput genome scale profiling study could only unravel molecular pathogenesis and suggest possible actionable therapeutic targets in these very rare pediatric tumors.

x

Hi!
I'm Shane!

Would you like to get a custom essay? How about receiving a customized one?

Check it out